circad | circRNAs associated with diseases

circRNA_100284
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Liver Cell Carcinoma	ICD-10	Malignant neoplasm of Liver, unspecified (C22.9)
DBLink	Link to database	PMID	28062277
Experimental Method
Sample Type	HaCaT Cell lines	Comparison	Normal and arsenite induced hepatic cell lines
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACTCACAATGATCCAAAAGGAGT Reverse GAGATACAGTGCATTCCAAGACA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Xue, J, Liu, Y, Luo, F, Lu, X, Xu, H, Liu, X, Lu, L, Yang, Q, Chen, C, Fan, W, Liu, Q (2017). Circ100284, via miR-217 regulation of EZH2, is involved in the arsenite-accelerated cell cycle of human keratinocytes in carcinogenesis. Biochim Biophys Acta Mol Basis Dis, 1863, 3:753-763.